HCV virus infection in spouses

Yoshihiro Akahane, MD; Mineo Kojima, MD; Yoshiki Sugai, MD; Minoru Sakamoto, MD; Yoshiki Miyazaki, MD; Takeshi Tanaka, BS; Fumio Tsuda, PhD; Shunji Mishiro, MD; Hiroaki Okamoto, MD; Yuzo Miyakawa, MD; and Makoto Mayumi, MD

Objective: Survey for markers of hepatitis C virus (Hepatitis C Virus) infection in spouses of patients with Hepatitis C Virus-related chronic liver disease.

Design: Cross-sectional clinical, serologic, and molecular biological study of spouses of patients with Hepatitis C Virus viremia and chronic liver disease.

Setting: University and city hospitals.

Participants: Spouses (52 men and 102 women; mean age, 56 ± 11 years) of 154 patients with Hepatitis C Virus viremia (102 men and 52 women; mean age, 58 ± 10 years), of whom 66 had chronic hepatitis, 49 had liver cirrhosis, and 39 had primary hepatocellular carcinoma.

Methods: Tests for Hepatitis C Virus-associated antibodies were done using a second-generation enzyme immunoassay and immunoassays with synthetic oligopeptides deduced from the Hepatitis C Virus core gene. Hepatitis C virus RNA was detected by polymerase chain reaction with primers deduced from the 5'-noncoding region and Hepatitis C Virus genotypes by reaction with type-specific primers deduced from the Hepatitis C Virus core gene.

Results: Hepatitis C virus-associated antibodies were detected in 42 (27%) spouses, of whom 25 were also positive for Hepatitis C Virus RNA. Of 112 (73%) spouses without detectable antibodies, 2 had chronic liver disease. The development of markers of Hepatitis C Virus infection in spouses increased with the duration of marriage, ranging from 1 to 60 years (30 ± 11 years).

Conclusions: Spouses of patients with Hepatitis C Virus viremia and chronic liver disease have an increased risk for acquiring Hepatitis C Virus, which is proportional to the duration of marriage. They should be followed routinely for markers of Hepatitis C Virus infection and liver disease.

From Yamanashi Medical College, Yamanashi-Ken, Kojima Clinic, Gifu-Ken; Iwaki Kyoritsu General Hospital, Fukushima-Ken; Japanese Red Cross Saitama Blood Center, Saitama- Ken; the Viral Hepatitis Research Foundation of Japan, Tokyo; Institute of Immunology, Tokyo; Jichi Medical School, Tochigi-Ken; and Mita Institute, Tokyo, Japan. For current author addresses,

The discovery by Choo and colleagues of hepatitis C virus (Hepatitis C Virus), the cause of most cases of blood-borne non-A, non-B hepatitis worldwide , allowed more accurate diagnosis and prevention of Hepatitis C Virus infection. Detection of antibody to Hepatitis C Virus (anti-Hepatitis C Virus) by enzyme immunoassays and determination of Hepatitis C Virus RNA by polymerase chain reaction (PCR) have proved useful in diagnosing Hepatitis C Virus-related acute and chronic liver disease and in preventing post-transfusion Hepatitis C Virus infection.

Hepatitis C virus is transmitted parenterally, typically by transfusion, illicit intravenous drugs, and accidental needle sticks . However, a defined parenteral exposure accounts for only one half of the reported cases of acute hepatitis C . Unlike hepatitis B virus infection, vertical transmission of Hepatitis C Virus infection from mother to infant is rare (. The route of Hepatitis C Virus transmission is unknown in most patients with hepatitis C and in most symptom-free Hepatitis C Virus carriers identified among blood donors by routine screening for anti-Hepatitis C Virus.

Sexual transmission of Hepatitis C Virus has been investigated in homosexual men , persons attending clinics for sexually transmitted diseases , spouses or sexual partners of patients with acute or chronic hepatitis C , and persons with hemophilia who are infected with Hepatitis C Virus . These studies indicate that Hepatitis C Virus is transmitted sexually only infrequently. Previous studies of sexual transmission of Hepatitis C Virus usually have been done in settings in which sexual contact was transient or in spouses married only for a limited time to patients with hepatitis. The situation can differ greatly, however, for spouses who have been married to patients with Hepatitis C Virus- related chronic liver disease for many decades. To determine if long-term spouses are at increased risk for Hepatitis C Virus infection, we measured Hepatitis C Virus-associated antibodies and Hepatitis C Virus RNA and determined Hepatitis C Virus genotypes in spouses of 154 patients with Hepatitis C Virus-related chronic liver disease, including 84 persons previously reported.

Methods

Spouses of consecutive patients at Yamanashi Medical College, Kojima Clinic, and Iwaki Kyoritsu General Hospital from October to December 1991 were studied. Most were referred from satellite medical facilities and screened for Hepatitis C Virus-associated antibodies. Patients with antibodies were tested for Hepatitis C Virus RNA. One hundred fifty-four patients were positive for both antibodies and Hepatitis C Virus RNA, including 66 patients with chronic hepatitis, 49 with liver cirrhosis, and 39 with primary hepatocellular carcinoma, of whom 102 were men (age, 58 ± 11 years) and 52 women (age, 57 ± 8 years). It was not known how long the patients had had clinical hepatitis or were infected with Hepatitis C Virus.

Their spouses, 102 women (age, 54 ± 12 years) and 52 men (age, 60 ± 9 years), were tested for Hepatitis C Virus-associated antibodies and Hepatitis C Virus RNA, and Hepatitis C Virus genotypes were determined. They were asked to complete a questionnaire addressing the duration of present marriage, history of transfusion, occurrence of premarital non-A, non-B hepatitis, experiences of illicit intravenous drugs, previous marriages, and extramarital sexual relationships.

We also studied nine spouses who were excluded from the cohort because they had risk factors other than marriage to patients infected with Hepatitis C Virus, such as a history of transfusion or premarital non-A, non-B hepatitis.

Hepatitis C Virus-associated Antibodies

Antihepatitis C virus was screened using a second-generation enzyme immunoassay (EIA-II, Ortho Diagnostic Systems; Tokyo, Japan) with absorbance at 492 nm (A492) values greater than 0.635 considered reactive. Antibody to a synthetic 36-mer peptide representing amino acids 39-74 of the product of the Hepatitis C Virus core gene (anti-CP9) and antibody to a synthetic 19-mer peptide representing amino acids 5-23 (anti-CP10) were determined by EIA by methods described previously and A492 values greater than 0.300 were considered positive.

Hepatitis C Virus RNA

The detection of Hepatitis C Virus RNA by PCR was done using a slight modification of the method described previously , with primers deduced from the 5'-noncoding region of the Hepatitis C Virus genome. Briefly, nucleic acids were extracted from 100 mL of serum, reverse-transcribed to cDNA using primer #299 (AC CCAACACTACTCGGCTAG, antisense, nucleotides [nt] 250- 269) and Moloney murine leukemia virus reverse transcriptase (Superscript, GIBCO-BRL; Gaithersburg, Maryland), and amplified by a two-stage PCR with AmpliTaq DNA polymerase (Perkin-Elmer Cetus; Norwalk, Connecticut). The first PCR was done with primer pair #32 (CTGTGAGGAACTACT GTCTT, sense, nt 45-64)/#299 for 35 cycles and the second PCR with #33 (TTCACGCAGAAAGCGTCTAG nt 63-82)/#48 (GTTGATCCAAGAAAGGACCC, nt 188-207) for 25 cycles; nucleotides were numbered from the putative 5`-end of the Hepatitis C Virus genome. Each cycle included denaturation at 94 °C for 45 seconds, primer annealing at 55 °C for 45 seconds, and primer extension at 72 °C for 90 seconds. The Hepatitis C Virus RNA assay was at least as sensitive as or 10³-fold more sensitive than that for detection of Hepatitis C Virus in chimpanzee transmission experiments (Unpublished observations).

Hepatitis C Virus Genotypes

Hepatitis C virus RNA samples in spouses and those in corresponding patients were classified in terms of genotypes I, II, III, IV, and V. A part of the Hepatitis C Virus core gene spanning nt 480-751 (272 base pairs [bp]) was amplified on Hepatitis C Virus cDNA with universal primers, #256 (CGCGCGACTAG GAAGACTTC nt 480-499) and #256V (CGCGCGACGCGTA AAACTTC, nt 480-499)/#186 (ATGTACCCCATGAGGT CGGC, nt 732-751). A portion of the product was amplified by PCR with two universal sense primers, #104 (AGGAAGACT TCCGAGCGGTC nt 489-508) and #104V (CGTAAAACTTC TGAACGGTC, nt 489-508), and the mixture of five antisense primers deduced from sequences of the Hepatitis C Virus core gene, #296 (GGATAGGCTGACGTCTACCT, nt 518-537), #133 (GAGC CATCCTGCCCACCCCA, nt 613-632), #134 (CCAAGAGG GACGGGAACCTC, nt 643-662), #135 (ACCCTCG TTTCCG TACAGAG, nt 592-611), and #339 (GCTGAGCCCAGGAC CGGTCT, nt 557-576), which were specific for genotypes I, II, III, IV, and V, respectively . The five genotypes were distinguished from one another by distinct sizes of PCR products: 49 bp for genotype I; 144 bp for II; 174 bp for III; 123 bp for IV; and 88 bp for V.

A typing method was proposed by Chan and colleagues and by Simmonds and coworkers that classifies Hepatitis C Virus isolates into three major types-1, 2, and 3-based on the phylogenetic relatedness, with each type divided into distinct subtypes. Subtypes 1a and 1b in this classification correspond to I and II, respectively; 2a and 2b to III and IV; and 3a and 3b to V and VI. In another classification by Houghton and colleagues and by Cha and coworkers , group I corresponds to genotype I (1a), group II to genotype II (1b), and group III to genotypes III (2a) and IV (2b); their group IV encompasses genotype V (3a) and group V includes a herd of variants reported only from South Africa so far.

Serologic Testing for the Other Viruses

Hepatitis B surface antigen was determined by passive hemagglutination with commercial assay kits (Mycell; Institute of Immunology, Co., Ltd., Tokyo, Japan). Antibody to human immunodeficiency virus type 1 was determined by passive agglutination of gelatin microparticles coated with viral antigens (SERODIA · HIV; Fuji Rebio, Tokyo, Japan).

Statistical Analysis

Frequencies between groups were compared using the chi- square test and the Fisher exact test. Exact confidence intervals were obtained by the standard method .

Results

Index patients with Hepatitis C Virus-related chronic liver disease included 66 with chronic hepatitis, 49 with cirrhosis, and 39 with hepatocellular carcinoma. They all tested positive for Hepatitis C Virus RNA as determined by PCR and for anti-Hepatitis C Virus by EIA-II. None had hepatitis B surface antigen or antibody to human immunodeficiency virus type 1.

The patients' 154 spouses were tested for markers of Hepatitis C Virus infection. The spouses included 52 husbands and 102 wives. None had been previously married, and all denied intravenous drug abuse or extramarital sexual contacts. None had received a transfusion or had a history of premarital non-A, non-B hepatitis.

Hepatitis C Virus Markers in Spouses of Patients

Anti-Hepatitis C Virus as detected by EIA-II, anti-CP9, or anti-CP10 was detected in 42 (27%) of 154 spouses, of whom 25 (16%) tested positive for Hepatitis C Virus RNA. Of the remaining 112 spouses without detectable Hepatitis C Virus-associated antibodies, 2 (2%) were positive for Hepatitis C Virus RNA. No appreciable differences were found in the diseases of the index patients married to spouses with Hepatitis C Virus markers and to those without these markers. Hepatitis C virus markers were detected in 17 (33%) of 52 husbands and in 27 (26%) of 102 wives of index patients.

Prevalence of Hepatitis C Virus antibodies and RNA increased in parallel with the duration of marriage (Figure 1). Hepatitis C virus markers were not detected in any of seven spouses who had been married to patients for fewer than 10 years. An increase therefore occurred in Hepatitis C Virus- associated antibodies and Hepatitis C Virus RNA detected in spouses proportional to the duration of marriage. Markers for Hepatitis C Virus were detected in three (60%) of five spouses married longer than 50 years. Of 87 spouses married longer than 30 years, Hepatitis C Virus RNA was detected in 21 (24%) compared with only 6 (9%) of 67 married less than 30 years (P < 0.05). Hepatitis C virus antibodies were also detected more frequently in the former group (28 of 87 [32%] compared with 14 of 67 [21%]). Logistic regression showed an increase in the odds of anti-Hepatitis C Virus positivity of 50% per decade of marriage (odds ratio, 1.5; 95% CI, 1.05 to 2.2; P = 0.01), and the odds of Hepatitis C Virus RNA positivity increased by 90% per decade (odds ratio, 1.9; 95% CI, 1.2 to 2.9; P = 0.004).

Of the 27 spouses with Hepatitis C Virus RNA, 24 (89%) were infected with Hepatitis C Virus of genotypes identical to those of index patients . The remaining three spouses had Hepatitis C Virus of genotypes different from those of patients. Thus, Hepatitis C Virus RNA of the genotypes identical to those in the index patients was detected in 24 (16%) of 154 spouses, including 14 (14%) of 102 wives and 10 (19%) of 52 husbands.

compares prevalences of Hepatitis C Virus antibodies and Hepatitis C Virus RNA in spouses of index patients classified by Hepatitis C Virus genotypes. No statistically significant differences were found in the prevalence of Hepatitis C Virus markers in spouses of patients infected with Hepatitis C Virus of genotype II, III, or IV, or with mixed genotypes (II and III).

Liver Diseases in Spouses Infected with Hepatitis C Virus

Of 24 spouses infected with Hepatitis C Virus of genotypes identical to patients, 8 had previously noted liver disease. Liver biopsy samples showed cirrhosis in one and chronic hepatitis in seven. Two additional spouses had elevated transaminase levels and were both found to have chronic hepatitis after liver biopsy. Thus, 10 spouses with apparent liver disease tested positive for Hepatitis C Virus-associated antibodies. The remaining 14 did not have elevated alanine aminotransferase levels, but Hepatitis C Virus-associated antibodies were detected in 12 (86%) of them. No appreciable differences were found between the 10 spouses with apparent liver disease and the 14 without liver disease in age (63 ± 8 compared with 56 ± 10 years) or duration of marriage (39 ± 8 compared with 32 ± 10 years).

Hepatitis C Virus Infection in Spouses with Other Risk Factors

Nine spouses with Hepatitis C Virus antibodies were excluded from the cohort because they had received transfusions or had a history of non-A, non-B hepatitis before the marriage. Four were positive for Hepatitis C Virus RNA. Hepatitis C virus genotypes were identical to those of patients in only one. The rate of identical Hepatitis C Virus genotypes in these four patients (1 of 4 [25%]) was lower than that (24 of 27 [89%]) in spouses without risk factors other than marriage to patients (P < 0.04).

Discussion

Hepatitis C virus-associated antibodies were detected in 42 (27%) and Hepatitis C Virus RNA in 27 (18%) of 154 spouses married to patients with viremia and Hepatitis C Virus-related chronic liver disease for periods of 1 to 60 years. The prevalence of Hepatitis C Virus antibodies among them was much higher than 1.5% in the general population and probably in age- and sex-matched subpopulations. In 24 (89%) of the 27 spouses with viremia, genotypes of Hepatitis C Virus were identical to those of the index patients: Nineteen were infected with Hepatitis C Virus of genotype II, four with genotype III, and one with mixed genotypes (II and III). Although discordance of Hepatitis C Virus genotypes may exclude the infection from suspected sources, concordance may not necessarily identify the route of infection. Restriction enzyme patterns and nucleotide sequences of Hepatitis C Virus cDNA from patients and spouses with viremia would have to be compared to establish transmission between them. Such technical reservations notwithstanding, the 24 spouses in this study probably acquired Hepatitis C Virus infection from their partners with Hepatitis C Virus- related chronic liver disease. This view is supported by concordance of Hepatitis C Virus genotypes in only one (25%) of four spouses with viremia who had risk factors other than the marriage.

The risk for Hepatitis C Virus infection increased with duration of marriage, ranging from 1 to 60 years (mean, 30 years). None of the seven spouses married to patients for fewer than 10 years had Hepatitis C Virus antibodies or Hepatitis C Virus RNA. The prevalence of Hepatitis C Virus markers gradually increased with the duration of marriage. Three (60%) of five spouses married for longer than 50 years had both anti-Hepatitis C Virus and Hepatitis C Virus RNA. Taken along with the lack of other risk factors for Hepatitis C Virus infection in the studied spouses, such as transfusion, history of hepatitis, intravenous drug abuse, extramarital sexual contact, or previous marriages, the observed correlation between development of Hepatitis C Virus markers and the duration of marriage over decades favors possible transmission of Hepatitis C Virus infection from patients to spouses.

The correlation between the duration of marriage and the development of Hepatitis C Virus infection in spouses presupposes that index patients were already infected at the time of marriage. However, because it is not known how long patients had clinically apparent disease or were infected with Hepatitis C Virus, the actual exposure time cannot be determined. Prospective studies are needed to establish the correlation of Hepatitis C Virus infection and the duration of sexual exposure but would require decades. A common source of infection for both patients and spouses is another possibility but would be rare considering the low rate of infectivity of Hepatitis C Virus for community-acquired or household infection, except between spouses. Sharing needles for illicit intravenous drugs would be the only plausible explanation for a common source infection, but none of the spouses or patients studied were drug abusers.

Our results support those of previous studies in some ways and contradict them in others. It has been claimed that sexual transmission of Hepatitis C Virus is infrequent based on screening of Hepatitis C Virus-associated antibodies in homosexual men and patients seen in sexually transmitted disease clinics . Hepatitis C virus is clearly less transmissible than hepatitis B virus or human immunodeficiency virus seen more frequently in such patients with sex-associated risk factors. In our study, Hepatitis C Virus infection was not found in any of the seven spouses married for fewer than 10 years to patients with Hepatitis C Virus-related chronic liver disease. Such a low rate of transmission to spouses is remarkable, considering that Hepatitis C Virus RNA levels in patients with chronic liver disease probably would be much higher than those in symptom-free carriers having transient extramarital sexual relations. Substantial rates of transmission have not been observed after transient sexual contacts to inconsistent partners with unspecified Hepatitis C Virus infection status or among spouses married to patients with acute hepatitis C for 1 year or less. Low estimates of risk have been based on studies documenting the lack or paucity of Hepatitis C Virus- associated antibodies in spouses or sexual partners of patients with chronic hepatitis C in which the risk is not correlated with the duration of marriage. Later studies have shown increased risk in family members of patients with chronic hepatitis C in which spouses have the highest risk , in agreement with our results. The term "sexual contact" encompasses a wide range of relationships. It includes extramarital affairs with changing partners for limited periods, as well as lifetime commitment to only one partner over many years. Low rates of sexual transmission of Hepatitis C Virus observed in some situations may not be extrapolated to others. Previous data therefore may not be applicable to spouses married to patients with Hepatitis C Virus-related chronic liver disease for many decades. Our results corroborate substantial heterosexual transmission of Hepatitis C Virus recently proposed by others

It is interesting that 10 (42%) of the 24 spouses with Hepatitis C Virus infection, probably acquired after marriage, had overt clinical disease. Eight had been attending liver clinics for some time before the study. The remaining two were identified by screening for Hepatitis C Virus markers and elevated transaminase levels in the course of the study, and both had chronic hepatitis diagnosed by liver biopsies. Because many Hepatitis C Virus-infected persons may be asymptomatic and have normal aminotransferase levels, and because liver biopsies were not done on the remaining 14 asymptomatic spouses infected with Hepatitis C Virus, we may have underestimated the extent of liver disease in these persons.

Spouses of patients with Hepatitis C Virus viremia and chronic liver disease have an increased risk for developing Hepatitis C Virus infection, and the risk increases over time. Spouses married to persons with demonstrable anti-Hepatitis C Virus, whether symptom-free carriers or patients with documented liver disease, should be screened for Hepatitis C Virus markers at regular intervals, perhaps twice a year, to receive prompt care if and when they become infected.

Acknowledgment: The authors thank Dr. Toshiro Tango for the statistical analysis of the data.

Requests for Reprints: Makoto Mayumi, MD, Immunology Division, Jichi Medical School, Tochigi-Ken 329-04, Japan.

Current Author Addresses: Drs. Akahane, Sakamoto, and Miyazaki: The First Department of Internal Medicine, Yamanashi Medical College, Yamanashi-Ken 409-38, Japan.
Dr. Kojima: Kojima Clinic, Gifu-Ken 500, Japan.
Dr. Sugai: Department of Internal Medicine, Iwaki Kyoritsu General Hospital, Fukushima-Ken 973, Japan.
Mr. Tanaka: Japanese Red Cross Saitama Blood Center, Saitama-Ken 362, Japan.
Dr. Tsuda: The Viral Hepatitis Research Foundation of Japan, Tokyo 113, Japan.
Dr. Mishiro: Institute of Immunology, Tokyo 112, Japan.
Drs. Okamoto and Mayumi: Immunology Division, Jichi Medical School, Tochigi-Ken 329-04, Japan.
Dr. Miyakawa: Mita Institute, Tokyo 108, Japan.

References

1. Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science. 1989;244:359-62.
2. Kuo G, Choo QL, Alter HJ, Gitnick GL, Redeker AG, Purcell RH, et al. An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science. 1989;244:362-4.
3. Alter MJ, Coleman PJ, Alexander WJ, Kramer E, Miller JK, Mandel E, et al. Importance of heterosexual activity in the transmission of hepatitis B and non-A, non-B hepatitis. JAMA. 1989;262:1201-5.
4. Dienstag JL. Non-A, non-B hepatitis. I. Recognition, epidemiology, and clinical features. Gastroenterology. 1983;85:439-62.
5. Alter MJ, Hadler SC, Judson FN, Mares A, Alexander WJ, Hu PY, et al. Risk factors for acute non-A, non-B hepatitis in the United States and association with hepatitis C virus infection. JAMA. 1990; 264:2231-5.
6. Wejstal R, Widell A, Mansson AS, Hermodsson S, Norkrans G. Mother-to-infant transmission of hepatitis C virus. Ann Intern Med. 1992;117:887-90.
7. Reinus JF, Leikin EL, Alter HJ, Cheung L, Shindo M, Jett B, et al. Failure to detect vertical transmission of hepatitis C virus. Ann Intern Med. 1992;117:881-6.
8. Melbye M, Biggar RJ, Wantzin P, Krogsgaard K, Ebbesen P, Becker NG. Sexual transmission of hepatitis C virus: cohort study (1981-9) among European homosexual men. BMJ. 1990;301:210-2.
9. Osmond DH, Charlebois E, Sheppard HW, Page K, Winkelstein W, Moss AR, et al. Comparison of risk factors for hepatitis C and hepatitis B virus infection in homosexual men. J Infect Dis. 1993; 167:66-71.
10. Weinstock HS, Bolan G, Reingold AL, Polish LB. Hepatitis C virus infection among patients attending a clinic for sexually transmitted diseases. JAMA. 1993;269:392-4.
11. Everhart JE, Di Bisceglie AM, Murray LM, Alter HJ, Melpolder JJ, Kuo G, et al. Risk for non-A, non-B (type C) hepatitis through sexual or household contact with chronic carriers. Ann Intern Med. 1990;112:544-5.
12. Shev S, Wejstal R, Wahl M, Hermodsson S, Norkrans G. The lack of transmission of NANB/C hepatitis between acute and chronically infected patients and their heterosexual partners. Scand J Infect Dis. 1991;23:407-11.
13. Gordon SC, Patel AH, Kulesza GW, Barnes RE, Silverman AL. Lack of evidence for the heterosexual transmission of hepatitis C. Am J Gastroenterol. 1992;87:1849-51.
14. Osmond DH, Padian NS, Sheppard HW, Glass S, Shiboski SC, Reingold A. Risk factors for hepatitis C virus seropositivity in heterosexual couples. JAMA. 1993;269:361-5.
15. Brettler DB, Mannucci PM, Gringeri A, Rasko JE, Forsberg AD, Rumi MG, et al. The low risk of hepatitis C virus transmission among sexual partners of hepatitis C-infected hemophiliac males: an international, multicenter study. Blood. 1992;80:540-3.
16. Akahane Y, Aikawa T, Sugai Y, Tsuda F, Okamoto H, Mishiro S. Transmission of Hepatitis C Virus between spouses [Letter]. Lancet. 1992;339: 1059-60.
17. Okamoto H, Munekata E, Tsuda F, Takahashi K, Yotsumoto S, Tanaka T, et al. Enzyme-linked immunosorbent assay for antibodies against the capsid protein of hepatitis C virus with a synthetic oligopeptide. Jpn J Exp Med. 1990;60:223-33.
18. Okamoto H, Tsuda F, Machida A, Munekata E, Akahane Y, Sugai Y, et al. Antibodies against synthetic oligopeptides deduced from the putative core gene for the diagnosis of hepatitis virus infection. Hepatology. 1992;15:180-6.
19. Okamoto H, Okada S, Sugiyama Y, Tanaka T, Sugai Y, Akahane Y, et al. Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5'- noncoding region. Jpn J Exp Med. 1990;60:215-22.
20. Okamoto H, Tokita H, Sakamoto M, Horikita M, Kojima M, Iizuka H, et al. Characterization of the genomic sequence of the type V (or 3a) hepatitis C virus isolates and PCR primers for specific detection. J Gen Virol. 1993;74:2385-90.
21. Mori S, Kato N, Yagyu A, Tanaka T, Ikeda Y, Petchclai B, et al. A new type of hepatitis C virus in patients in Thailand. Biochem Biophys Res Commun. 1992;183:334-42.
22. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, et al. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J Gen Virol. 1992;73:673-9.
23. Okamoto H, Kurai K, Okada S, Yamamoto K, Iizuka H, Tanaka T, et al. Full-length sequence of a hepatitis C virus genome having poor homology to reported isolates: comparative study of four distinct genotypes. Virology. 1992;188:331-41.
24. Chan SW, McOmish F, Holmes EC, Dow B, Peutherer JF, Follett E, et al. Analysis of a new hepatitis C virus type and its phylogenetic relationship to existing variants. J Gen Virol. 1992;73:1131-41.
25. Simmonds P, McOmish F, Yap PL, Chan SW, Lin CK, Dusheiko G, et al. Sequence variability in the 5` non-coding region of hepatitis C virus: identification of a new virus type and restrictions on sequence diversity. J Gen Virol. 1993;74:661-8.
26. Houghton M, Weiner A, Han J, Kuo G, Choo QL. Molecular biology of the hepatitis C viruses: implications for diagnosis, development and control of viral disease. Hepatology. 1991;14:381-8.
27. Cha TA, Beall E, Irvine B, Kolberg J, Chien D, Kuo G, et al. At least five related, but distinct, hepatitis C viral genotypes exist. Proc Natl Acad Sci U S A. 1992;89:7144-8.
28. Clopper CJ, Pearson ES. The use of confidence or fiducial limits illustrated in the case of binomial. Biometrika. 1934;26:404-14.
29. Watanabe J, Matsumoto C, Fujimura K, Shimada T, Yoshizawa H, Okamoto H, et al. Predictive value of screening tests for persistent hepatitis C virus infection evidenced by viraemia: Japanese experience. Vox Sang. 1993;65:199-203.
30. Kao JH, Chen PJ, Yang PM, Lai MY, Sheu JC, Wang TH, et al. Intrafamilial transmission of hepatitis C virus: the important role of infections between spouses. J Infect Dis. 1992;166:900-3.
31. Oshita M, Hayashi N, Kasahara A, Yuki N, Takehara T, Hagiwara H, et al. Prevalence of hepatitis C virus in family members of patients with hepatitis C. J Med Virol. 1993;41:251-5.
32. Peano GM, Fenoglio LM, Menardi G, Balbo R, Marenchino D, Fenoglio S. Heterosexual transmission of hepatitis C virus in family groups without risk factors. BMJ. 1992;305:1473-4.